Basic information from miRBase |
hairpin accession number: MI0011291 |
Located between position 10222121 and 10222223 on chromosome 3R strand - |
Overlapping with sense strand of cv-c-RA (intron 2). |
(Ensemble: FBtr0112631) (FlyBase: FlyBase) |
mature miRNAs for MI0011291: |
dme-miR-2281-5p (MIMAT0011788): ATTATCTGCAGCTGCAGATGCAA |
dme-miR-2281-3p (MIMAT0011789): TATCTGTATCTGCAGTATTGC |
References |
[1]Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC, Genome Res. 19:1776-1785(2009)., "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" |