| Basic information from miRBase |
| hairpin accession number: MI0008536 |
| Located between position 53551724 and 53551812 on chromosome 3 strand - |
| mature miRNAs for MI0008536: |
| ptr-miR-135a (MIMAT0002252): TATGGCTTTTTATTCCTATGTGA |
| You can find this miRNA in ENTREZGENE: MIR135A-1 (accession: 100316098) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |