miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013848
Located between position 713415 and 713500 on chromosome 26_random strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018393)
mature miRNAs for MI0013848:
         tgu-miR-135a (MIMAT0014559): TATGGCTTTTTATTCCTATGTGA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"