| Basic information from miRBase |
| hairpin accession number: MI0002077 |
| Located between position 67759741 and 67759836 on chromosome 5 strand - |
| Overlapping with sense strand of si:ch211-233f10.5-001 (intron 3). |
| (Ensemble: OTTDART00000023198) |
| mature miRNAs for MI0002077: |
| dre-miR-455 (MIMAT0001879): TATGTGCCCTTGGACTACATCG |
| You can find this miRNA in ENTREZGENE: mir455 (accession: 100033792) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |
| [2]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |