miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005049
Located between position 108764289 and 108764377 on chromosome 8 strand +
Overlapping with sense strand of Q148M4_BOVIN (intron 10).
(Ensemble: ENSBTAT00000001200)
mature miRNAs for MI0005049:
         bta-miR-455 (MIMAT0003835): TATGTGCCTTTGGACTACATC
         bta-miR-455* (MIMAT0003836): GCAGTCCATGGGCATATACACT
You can find this miRNA in ENTREZGENE: MIR455 (accession: 791048)

References
[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"