| Basic information from miRBase |
| hairpin accession number: MI0010854 |
| Located between position 48921092 and 48921201 on chromosome 20 strand + |
| Overlapping with antisense strand of si:ch211-284a16.4-003 (intron 3). |
| (Ensemble: OTTDART00000030421) |
| mature miRNAs for MI0010854: |
| dre-miR-2193 (MIMAT0011314): TATGTGTGTATCAATTGTGTGAAA |
| You can find this miRNA in ENTREZGENE: mir2193 (accession: 100310762) |
| References |
| [1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |