| Basic information from miRBase |
| hairpin accession number: MI0012531 |
| Located between position 187066854 and 187066922 on chromosome 1 strand + |
| Overlapping with sense strand of Snora36b-201 (exon 1). |
| (Ensemble: ENSMUST00000104383) |
| mature miRNAs for MI0012531: |
| mmu-miR-664* (MIMAT0017353): CTGGCTGGGGAAAATGACTGG |
| mmu-miR-664 (MIMAT0012774): TATTCATTTACTCCCCAGCCTA |
| You can find this miRNA in ENTREZGENE: Mir664 (accession: 100316737) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" |
| [3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" |