| Basic information from miRBase |
| hairpin accession number: MI0012940 |
| Located between position 10420840 and 10420913 on chromosome 30 strand - |
| Overlapping with sense strand of RAB3GAP2 (intron 9). |
| (Ensemble: ENSECAT00000019433) |
| mature miRNAs for MI0012940: |
| eca-miR-664 (MIMAT0013192): TATTCATTTATCTCCTAGCCTACA |
| You can find this miRNA in ENTREZGENE: MIR664 (accession: 100314932) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |