| Basic information from miRBase |
| hairpin accession number: MI0009796 |
| Located between position 103684285 and 103684354 on chromosome 8 strand - |
| Overlapping with sense strand of LOC521172 (intron 14). |
| (Ensemble: ENSBTAT00000053653) |
| mature miRNAs for MI0009796: |
| bta-miR-32 (MIMAT0009283): TATTGCACATGACTAAGTTGCAT |
| You can find this miRNA in ENTREZGENE: MIR32 (accession: 100313372) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [3]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |