| Basic information from miRBase |
| hairpin accession number: MI0015548 |
| Located between position 40039 and 40091 on chromosome scaffold_368 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSCINT00000029545) |
| mature miRNAs for MI0015548: |
| cin-miR-4009a-5p (MIMAT0016501): GGTTTTCCATGTGTAAGAGC |
| cin-miR-4009a-3p (MIMAT0016502): TATTGCACATGTTGTACCAA |
| You can find this miRNA in ENTREZGENE: mir4009a (accession: 100499087) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |