| Basic information from miRBase |
| hairpin accession number: MI0002678 |
| Located between position 108464759 and 108464828 on chromosome 9 strand - |
| Overlapping with sense strand of XM_520176.2 (intron 14). |
| (Ensemble: ENSPTRT00000039262) |
| mature miRNAs for MI0002678: |
| ptr-miR-32 (MIMAT0002386): TATTGCACATTACTAAGTTGC |
| You can find this miRNA in EMBL: AY866026 (accession: AY866026) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |