| Basic information from miRBase |
| hairpin accession number: MI0013812 |
| Located between position 89259080 and 89259150 on chromosome 2 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSTGUT00000018671) |
| mature miRNAs for MI0013812: |
| tgu-miR-32 (MIMAT0014584): TATTGCACATTACTAAGTTGC |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |