| Basic information from miRBase |
| hairpin accession number: MI0009906 |
| Located between position 16805639 and 16805734 on chromosome 3 strand - |
| mature miRNAs for MI0009906: |
| bta-miR-92b (MIMAT0009384): TATTGCACTCGTCCCGGCCTCC |
| You can find this miRNA in ENTREZGENE: MIR92B (accession: 100313088) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |