| Basic information from miRBase |
| hairpin accession number: MI0012987 |
| Located between position 106692042 and 106692116 on chromosome X strand - |
| mature miRNAs for MI0012987: |
| eca-miR-92a (MIMAT0013089): TATTGCACTTGTCCCGGCCTGT |
| You can find this miRNA in ENTREZGENE: MIR92A-2 (accession: 100315098) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |