miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007160
Located between position 1864426 and 1864526 on chromosome 3p strand +
mature miRNAs for MI0007160:
         cin-miR-92a* (MIMAT0015253): CGGCTGGTACAAGAGCACGA
         cin-miR-92a (MIMAT0006096): TATTGCACTTGTCCCGGTCTT
You can find this miRNA in ENTREZGENE: mir92a (accession: 100187676)

References
[1]Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T, BMC Genomics. 8:445(2007)., "Computational prediction and experimental validation of Ciona intestinalis microRNA genes"
[2]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica"
[3]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"


more data
Data from CoGemiR