| Basic information from miRBase |
| hairpin accession number: MI0011851 |
| Located between position 29960378 and 29960594 on chromosome MtChr8 strand - |
| mature miRNAs for MI0011851: |
| mtr-miR2601 (MIMAT0013304): TATTTGGTATCGCTTTGGTCCC |
| References |
| [1]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" |