Basic information from miRBase |
hairpin accession number: MI0015738 |
Located between position 898374 and 898429 on chromosome 10p strand + |
Overlapping with sense strand of (intron 2). |
(Ensemble: ENSCINT00000027030) |
mature miRNAs for MI0015738: |
cin-miR-4182-5p (MIMAT0016796): CATAATGGAGGTTTTTTACT |
cin-miR-4182-3p (MIMAT0016797): TCAAAAAATCTGCAGAATG |
You can find this miRNA in ENTREZGENE: mir4182 (accession: 100499135) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |