| Basic information from miRBase |
| hairpin accession number: MI0008530 |
| Located between position 59350964 and 59351035 on chromosome 19 strand + |
| mature miRNAs for MI0008530: |
| ptr-miR-1323 (MIMAT0008028): TCAAAACTGAGGGGCATTTTCT |
| You can find this miRNA in ENTREZGENE: MIR1323 (accession: 100316095) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |