| Basic information from miRBase |
| hairpin accession number: MI0009722 |
| Located between position 22162538 and 22162617 on chromosome X strand - |
| Overlapping with sense strand of GBRA3_BOVIN (intron 1). |
| (Ensemble: ENSBTAT00000008798) |
| mature miRNAs for MI0009722: |
| bta-miR-105b (MIMAT0009216): TCAAATGCTCAGACTCCTTGGT |
| You can find this miRNA in ENTREZGENE: MIR105B (accession: 100312990) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |