| Basic information from miRBase |
| hairpin accession number: MI0009804 |
| Located between position 97493656 and 97493747 on chromosome 4 strand + |
| Overlapping with sense strand of MEST_BOVIN (intron 2). |
| (Ensemble: ENSBTAT00000044831) |
| mature miRNAs for MI0009804: |
| bta-miR-335 (MIMAT0009291): TCAAGAGCAATAACGAAAAATGT |
| You can find this miRNA in ENTREZGENE: MIR335 (accession: 100313352) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [3]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |