Basic information from miRBase |
hairpin accession number: MI0000816 |
Located between position 130135952 and 130136045 on chromosome 7 strand + |
Overlapping with sense strand of MEST-012 (intron 2). |
(Ensemble: OTTHUMT00000345200) |
mature miRNAs for MI0000816: |
hsa-miR-335 (MIMAT0000765): TCAAGAGCAATAACGAAAAATGT |
hsa-miR-335* (MIMAT0004703): TTTTTCATTATTGCTCCTGACC |
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-335 (accession: hsa-miR-335) |
References | ||||||||||||||
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" ![]() | ||||||||||||||
[2]Weber MJ, FEBS J. 272:59-73(2005)., "New human and mouse microRNA genes found by homology search" ![]() | ||||||||||||||
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" ![]() | ||||||||||||||
[4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" ![]() |
PROMOTER INFORMATION | ||||||||||||||
387 | chr7, 129913181-129913381, + | promoter sequence | Marson et al. ![]() | ![]() | ![]() | |||||||||
388 | chr7, 129919123-129919323, + | promoter sequence | Marson et al. ![]() | ![]() | ![]() | |||||||||
726 | chr7, 129918188-129923281, + | promoter sequence | UCSC | ![]() | ![]() |
This microRNA is imprinted (based on ncRNAimprinted database) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |