Basic information from miRBase |
hairpin accession number: MI0008623 |
Located between position 130928723 and 130928815 on chromosome 7 strand + |
Overlapping with sense strand of (intron 2). |
(Ensemble: ENSPTRT00000055184) |
mature miRNAs for MI0008623: |
ptr-miR-335 (MIMAT0008104): TCAAGAGCAATAACGAAAAATGT |
You can find this miRNA in ENTREZGENE: MIR335 (accession: 100316143) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |