miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000418

Located between position 5508756 and 5508843 on chromosome 2R strand -

Overlapping with sense strand of Mmp2-RB (intron 3).

(Ensemble: FBtr0088501) (FlyBase: FlyBase)

mature miRNAs for MI0000418:

dme-miR-307a-5p (MIMAT0020832): ACTCACTCAACCTGGGTGTGAT

dme-miR-307a-3p (MIMAT0000398): TCACAACCTCCTTGAGTGAG

You can find this miRNA in TARGETS:MIRTE: miR-307 (accession: miR-307)

References

[1]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"

[2]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[3]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"