miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010640
mature miRNAs for MI0010640:
         lmi-miR-307* (MIMAT0010136): ACTCACTCAACCTGGGTGTGATG
         lmi-miR-307 (MIMAT0010137): TCACAACCTCCTTGAGTGAGCGA

References
[1]Wei Y, Chen S, Yang P, Ma Z, Kang L, Genome Biol. 10:R6(2009)., "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust"