| Basic information from miRBase |
| hairpin accession number: MI0015283 |
| Located between position 2964 and 3041 on chromosome emb|CABF01007682.1| strand - |
| mature miRNAs for MI0015283: |
| sja-miR-2a-5p (MIMAT0016245): CAGTCAATATTGGCTGATGGCA |
| sja-miR-2a-3p (MIMAT0016246): TCACAGCCAGTATTGATGAACG |
| References |
| [1]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |