| Basic information from miRBase |
| hairpin accession number: MI0015489 |
| Located between position 102409 and 102465 on chromosome scaffold_92 strand - |
| Overlapping with sense strand of (intron 12). |
| (Ensemble: ENSCINT00000002313) |
| mature miRNAs for MI0015489: |
| cin-miR-135-5p (MIMAT0016409): TATGGCTTTCTTTTCCTGTGTG |
| cin-miR-135-3p (MIMAT0016410): TCACAGTAAAGTAAGCCATTATC |
| You can find this miRNA in ENTREZGENE: mir135 (accession: 100498865) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |