miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007617
Located between position 178154004 and 178154087 on chromosome 2 strand +
Overlapping with sense strand of XM_001101315.1 (intron 15).
(Ensemble: ENSMMUT00000022443)
mature miRNAs for MI0007617:
         mml-miR-128b (MIMAT0006184): TCACAGTGAACCGGTCTCTTT
You can find this miRNA in ENTREZGENE: MIR128B (accession: 100315510)

References
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome"