Basic information from miRBase |
hairpin accession number: MI0007617 |
Located between position 178154004 and 178154087 on chromosome 2 strand + |
Overlapping with sense strand of XM_001101315.1 (intron 15). |
(Ensemble: ENSMMUT00000022443) |
mature miRNAs for MI0007617: |
mml-miR-128b (MIMAT0006184): TCACAGTGAACCGGTCTCTTT |
You can find this miRNA in ENTREZGENE: MIR128B (accession: 100315510) |
References |
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" ![]() |