Basic information from miRBase |
hairpin accession number: MI0002519 |
Located between position 139835031 and 139835112 on chromosome 2b strand + |
Overlapping with sense strand of XM_001154157.1 (intron 15). |
(Ensemble: ENSPTRT00000023181) |
mature miRNAs for MI0002519: |
ptr-miR-128 (MIMAT0002230): TCACAGTGAACCGGTCTCTTT |
You can find this miRNA in EMBL: AY865857 (accession: AY865857) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |