miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002519
Located between position 139835031 and 139835112 on chromosome 2b strand +
Overlapping with sense strand of XM_001154157.1 (intron 15).
(Ensemble: ENSPTRT00000023181)
mature miRNAs for MI0002519:
         ptr-miR-128 (MIMAT0002230): TCACAGTGAACCGGTCTCTTT
You can find this miRNA in EMBL: AY865857 (accession: AY865857)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"