| Basic information from miRBase |
| hairpin accession number: MI0008482 |
| Located between position 36576059 and 36576141 on chromosome 3 strand + |
| Overlapping with sense strand of XM_001169995.1 (intron 17). |
| (Ensemble: ENSPTRT00000027560) |
| mature miRNAs for MI0008482: |
| ptr-miR-128 (MIMAT0002230): TCACAGTGAACCGGTCTCTTT |
| You can find this miRNA in ENTREZGENE: MIR128-2 (accession: 100316077) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |