miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013711
Located between position 28894377 and 28894486 on chromosome 2 strand -
Overlapping with sense strand of (intron 16).
(Ensemble: ENSTGUT00000001779)
mature miRNAs for MI0013711:
         tgu-miR-128* (MIMAT0014540): GACCCCGTGCGGCTGGAAG
         tgu-miR-128 (MIMAT0014513): TCACAGTGAACCGGTCTCTTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"