| Basic information from miRBase |
| hairpin accession number: MI0015554 |
| Located between position 505109 and 505164 on chromosome scaffold_89 strand - |
| mature miRNAs for MI0015554: |
| cin-miR-4011b-5p (MIMAT0016510): TCACAGTGGAGGTATACCTT |
| cin-miR-4011b-3p (MIMAT0016511): ACGGTAGCATTCACTGTAAC |
| You can find this miRNA in ENTREZGENE: mir4011b (accession: 100499026) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |