miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011111
Located between position 223069 and 223163 on chromosome Crem_Contig93 strand -
mature miRNAs for MI0011111:
         crm-miR-35c* (MIMAT0011613): CACTGGTTTTAGCTTCGGTG
         crm-miR-35c (MIMAT0011512): TCACCGGGTGAAAATCAGGGC

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"