| Basic information from miRBase |
| hairpin accession number: MI0016014 |
| Located between position 27559190 and 27559284 on chromosome 8 strand - |
| mature miRNAs for MI0016014: |
| hsa-miR-3622b-5p (MIMAT0018005): AGGCATGGGAGGTCAGGTGA |
| hsa-miR-3622b-3p (MIMAT0018006): TCACCTGAGCTCCCGTGCCTG |
| You can find this miRNA in ENTREZGENE: MIR3622B (accession: 100500871) |
| References |
| [1]Witten D, Tibshirani R, Gu SG, Fire A, Lui WO, BMC Biol. 8:58(2010)., "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" |