| Basic information from miRBase |
| hairpin accession number: MI0013859 |
| Located between position 345532 and 345612 on chromosome nscaf2176 strand - |
| mature miRNAs for MI0013859: |
| bmo-miR-2733h (MIMAT0014663): TCACTGGGTGTATGATGATTG |
| References |
| [1]Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R, BMC Genomics. 11:52(2010)., "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" |