| Basic information from miRBase |
| hairpin accession number: MI0008430 |
| Located between position 127760898 and 127760969 on chromosome 8 strand + |
| mature miRNAs for MI0008430: |
| ptr-miR-1208 (MIMAT0007962): TCACTGTTCAGACAGGCGGA |
| You can find this miRNA in ENTREZGENE: MIR1208 (accession: 100316517) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |