| Basic information from miRBase |
| hairpin accession number: MI0008745 |
| Located between position 73649330 and 73649434 on chromosome X strand - |
| mature miRNAs for MI0008745: |
| ptr-miR-545 (MIMAT0008217): TCAGCAAACATTTATTGTGTGC |
| You can find this miRNA in ENTREZGENE: MIR545 (accession: 100316209) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |