| Basic information from miRBase |
| hairpin accession number: MI0009982 |
| Located between position 15104178 and 15104254 on chromosome 16 strand - |
| Overlapping with antisense strand of PDXDC1-001 (intron 8). |
| (Ensemble: OTTHUMT00000389065) |
| mature miRNAs for MI0009982: |
| hsa-miR-1972 (MIMAT0009447): TCAGGCCAGGCACAGTGGCTCA |
| You can find this miRNA in HGNC: MIR1972 (accession: 37060) |
| References |
| [1]Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML, Leukemia. 23:313-322(2009)., "Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia" |