miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002180
Located between position 1275348 and 1275428 on chromosome 1 strand +
mature miRNAs for MI0002180:
         dre-miR-459 (MIMAT0001886): TCAGTAACAAGGATTCATCCTG
         dre-miR-459* (MIMAT0003408): CAGGGAATCTCTGTTACTGGGG
You can find this miRNA in ENTREZGENE: mir459 (accession: 100033529)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"