| Basic information from miRBase |
| hairpin accession number: MI0012320 |
| Located between position 161868 and 161940 on chromosome nscaf2686 strand - |
| mature miRNAs for MI0012320: |
| bmo-miR-2766* (MIMAT0013641): CCGCCCTTCGTCTTGACTGGCG |
| bmo-miR-2766 (MIMAT0013642): TCAGTCTTGTCGAATGGTG |
| References |
| [1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing" |
| [2]Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R, BMC Genomics. 11:52(2010)., "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" |