| Basic information from miRBase |
| hairpin accession number: MI0008547 |
| Located between position 26274680 and 26274746 on chromosome 7 strand - |
| mature miRNAs for MI0008547: |
| ptr-miR-148a (MIMAT0008041): TCAGTGCACTACAGAACTTTGT |
| You can find this miRNA in ENTREZGENE: MIR148A (accession: 100316104) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |