| Basic information from miRBase |
| hairpin accession number: MI0008548 |
| Located between position 35180529 and 35180626 on chromosome 12 strand - |
| mature miRNAs for MI0008548: |
| ptr-miR-148b (MIMAT0008042): TCAGTGCATCACAGAACTTTGT |
| You can find this miRNA in ENTREZGENE: MIR148B (accession: 100316105) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |