| Basic information from miRBase |
| hairpin accession number: MI0013118 |
| Located between position 18088734 and 18088813 on chromosome 5 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000020589) |
| mature miRNAs for MI0013118: |
| ssc-miR-148b (MIMAT0013901): TCAGTGCATCACAGAACTTTGT |
| You can find this miRNA in ENTREZGENE: MIR148B (accession: 100498786) |
| References |
| [1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |