| Basic information from miRBase |
| hairpin accession number: MI0008552 |
| Located between position 9713314 and 9713399 on chromosome 17 strand + |
| mature miRNAs for MI0008552: |
| ptr-miR-152 (MIMAT0008046): TCAGTGCATGACAGAACTTGG |
| You can find this miRNA in ENTREZGENE: MIR152 (accession: 100316446) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |