Basic information from miRBase |
hairpin accession number: MI0005827 |
Located between position 12530369 and 12530463 on chromosome X strand + |
Overlapping with sense strand of tomosyn-RC (intron 2). |
(Ensemble: FBtr0073678) (FlyBase: FlyBase) |
mature miRNAs for MI0005827: |
dme-miR-970-5p (MIMAT0020867): AGCTAGCGGGTGTTTTATTTGGTA |
dme-miR-970-3p (MIMAT0005486): TCATAAGACACACGCGGCTAT |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" ![]() |
[2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" ![]() |
more data |
Data from CoGemiR |