miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011118
Located between position 221632 and 221748 on chromosome Crem_Contig74 strand -
mature miRNAs for MI0011118:
         crm-miR-2228 (MIMAT0011625): TCATCCATCTCTGAAATTAGAC

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"