miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010888
Located between position 61406228 and 61406311 on chromosome 6 strand -
mature miRNAs for MI0010888:
         sbi-miR393b (MIMAT0011348): TCCAAAGGGATCGCATTGATC

References
[1]Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare, Nature. 457:551-556(2009)., "The Sorghum bicolor genome and the diversification of grasses"