miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007952
Located between position 17247187 and 17247312 on chromosome 16 strand -
mature miRNAs for MI0007952:
         vvi-miR393a (MIMAT0006557): TCCAAAGGGATCGCATTGATC
You can find this miRNA in ENTREZGENE: MIR393A (accession: 100272029)

References
[1]Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2]Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"