| Basic information from miRBase |
| hairpin accession number: MI0012781 |
| Located between position 1976416 and 1976474 on chromosome 11 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSECAT00000022757) |
| mature miRNAs for MI0012781: |
| eca-miR-338-5p (MIMAT0013035): AACAATATCCTGGTGCTGAGTG |
| eca-miR-338-3p (MIMAT0013036): TCCAGCATCAGTGATTTTGTTG |
| You can find this miRNA in ENTREZGENE: MIR338 (accession: 100315012) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |