| Basic information from miRBase |
| hairpin accession number: MI0008625 |
| Located between position 81310408 and 81310473 on chromosome 17 strand - |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSPTRT00000017918) |
| mature miRNAs for MI0008625: |
| ptr-miR-338 (MIMAT0008106): TCCAGCATCAGTGATTTTGTTG |
| You can find this miRNA in ENTREZGENE: MIR338 (accession: 100316461) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |