| Basic information from miRBase |
| hairpin accession number: MI0007707 |
| Located between position 84714873 and 84714944 on chromosome X strand - |
| Overlapping with sense strand of XM_001083432.1 (intron 9). |
| (Ensemble: ENSMMUT00000023568) |
| mature miRNAs for MI0007707: |
| mml-miR-361-5p (MIMAT0006286): TTATCAGAATCTCCAGGGGTAC |
| mml-miR-361-3p (MIMAT0006287): TCCCCCAGGTGTGATTCTGATTT |
| You can find this miRNA in ENTREZGENE: MIR361 (accession: 100315242) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |